Explore
Explora Plasmids and Lentivectors of Annotated proteins
Related Genes
Structrural Annotation Protein from cDNA clone

- PDB reference: chorismate mutase/prephenate dehydrogenase, 2pv7
 - 3D view
 


Topsan Sequencing Primers
- We have primers to sequence verify gene inserts for most of the plasmids avialable in the TOPSAN repository.
 - Not used for Sanger or Next Generation sequencing
 

ABM's Sequencing Primers
Primer Name
Primer Sequence
Primer Name
                                           Primer Sequence
AttP2 
                                          CAGGAAACAGCTATGAC
M13F
                                              GTAAAACGACGGCCAGT
M13R
                                             CAGGAAACAGCTATGACC
NAP138R
                                             TGTTTCGCCATTTATCACCTTC
NAP150
                                             CCCATTGTATGGGATCTGATC
T7
                                             TAATACGACTCACTATAG
T7 terminator
                                              GCTAGTTATTGCTCAGCGG
Topsan Accesssion Numbers
| Gene ID | Gene Symbol | Gene Name | Reference Sequence Genbank Accession | Reference Sequence GI | Vector | 
| 896836 | TM0021 | hypothetical protein | NP_227837 | 15642796 | pMH1 | 
| 896861 | TM0038 | 6-pyruvoyl tetrahydrobiopterin synthase | NP_227854 | 15642813 | pMH1 | 
| 896878 | TM0054 | hypothetical protein | NP_227870 | 15642829 | pMH1 | 
| 896898 | TM0073 | peptide ABC transporter permease | NP_227889 | 15642848 | pMH1 | 
| 896920 | TM0093 | hypothetical protein | NP_227909 | 15642868 | pMH1 | 
| 896968 | TM0138 | tryptophan synthase subunit beta | NP_227953 | 15642912 | pMH2T7 | 
| 896993 | TM0156 | alkaline phosphatase | NP_227971 | 15642930 | pMH2T7 | 
| 896810 | TM0002 | hypothetical protein | NP_227818 | 15642777 | pMH1 | 
| 896838 | TM0023 | methyl-accepting chemotaxis protein | NP_227839 | 15642798 | pMH2T7 | 
| 896879 | TM0055 | alpha-glucuronidase | NP_227871 | 15642830 | pMH2T7 | 
| 896900 | TM0075 | peptide ABC transporter ATP-binding protein | NP_227891 | 15642850 | pMH1 | 
| 896922 | TM0095 | hypothetical protein | NP_227911 | 15642870 | pMH1 | 
| 896969 | TM0139 | N-(5'-phosphoribosyl)anthranilate isomerase | NP_227954 | 15642913 | pMH2T7 | 
| 896995 | TM0157 | actinorhodin polyketide dimerase | NP_227972 | 15642931 | pMH2T7 | 
| 896817 | TM0008 | hypothetical protein | NP_227824 | 15642783 | pMH1 | 
| 896840 | TM0024 | laminarinase | NP_227840 | 15642799 | pMH2T7 | 
| 896864 | TM0040 | dihydropteroate synthase | NP_227856 | 15642815 | pMH2T7 | 
| 896880 | TM0056 | peptide ABC transporter substrate-binding protein | NP_227872 | 15642831 | pMH2T7 | 
| 896903 | TM0077 | acetyl xylan esterase | NP_227893 | 15642852 | pMH1 | 
| 896970 | TM0140 | indole-3-glycerol phosphate synthase | NP_227955 | 15642914 | pMH1 | 
| 897005 | TM0166 | folylpolyglutamate synthase/dihydrofolate synthase | NP_227981 | 15642940 | pMH2T7 | 
| 896818 | TM0009 | hypothetical protein | NP_227825 | 15642784 | pMH1 | 
| 896866 | TM0042 | aminopeptidase | NP_227858 | 15642817 | pMH1 | 
| 896883 | TM0059 | peptide ABC transporter permease | NP_227875 | 15642834 | pMH1 | 
| 896905 | TM0079 | iron(III) ABC transporter permease | NP_227895 | 15642854 | pMH2T7 | 
| 896973 | TM0143 | response regulator | NP_227958 | 15642917 | pMH1 | 
| 897009 | TM0170 | hypothetical protein | NP_227985 | 15642944 | pMH2T7 | 
| 896823 | TM0012 | NADP-reducing hydrogenase, subunit A | NP_227828 | 15642787 | pMH2T7 | 
| 896845 | TM0027 | peptide ABC transporter ATP-binding protein | NP_227843 | 15642802 | pMH1 | 
| 896884 | TM0060 | peptide ABC transporter permease | NP_227876 | 15642835 | pMH1 | 
| 896907 | TM0080 | iron ABC transporter substrate-binding protein | NP_227896 | 15642855 | pMH1 | 
| 896950 | TM0123 | zinc ABC transporter substrate-binding protein | NP_227939 | 15642898 | pMH2T7 | 
| 896980 | TM0147 | hypothetical protein | NP_227962 | 15642921 | pMH2T7 | 
| 897011 | TM0172 | S-adenosyl-L-homocysteine hydrolase | NP_227987 | 15642946 | pMH1 | 
| 896848 | TM0028 | peptide ABC transporter ATP-binding protein | NP_227844 | 15642803 | pMH1 | 
| 896869 | TM0045 | hypothetical protein | NP_227861 | 15642820 | pMH1 | 
| 896888 | TM0064 | glucuronate isomerase | NP_227880 | 15642839 | pMH2T7 | 
| 896909 | TM0082 | flagellar hook-associated protein 3 | NP_227898 | 15642857 | pMH1 | 
| 896953 | TM0126 | response regulator | NP_227942 | 15642901 | pMH2T7 | 
| 897016 | TM0176 | hypothetical protein | NP_227991 | 15642950 | pMH2T7 | 
| 896826 | TM0014 | methyl-accepting chemotaxis protein | NP_227830 | 15642789 | pMH1 | 
| 896852 | TM0031 | peptide ABC transporter substrate-binding protein | NP_227847 | 15642806 | pMH2T7 | 
| 896870 | TM0046 | hypothetical protein | NP_227862 | 15642821 | pMH1 | 
| 896890 | TM0066 | 2-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase | NP_227882 | 15642841 | pMH2T7 | 
| 896911 | TM0084 | hypothetical protein | NP_227900 | 15642859 | pMH2T7 | 
| 896955 | TM0128 | oxaloacetate decarboxylase | NP_227944 | 15642903 | pMH2T7 | 
| 896984 | TM0149 | glycerol-3-phosphate acyltransferase PlsX | NP_227964 | 15642923 | pMH2T7 | 
| 897017 | TM0177 | hypothetical protein | NP_227992 | 15642951 | pMH2T7 | 
| 896829 | TM0015 | pyruvate ferredoxin oxidoreductase, gamma subunit | NP_227831 | 15642790 | pMH1 | 
| 896854 | TM0033 | hypothetical protein | NP_227849 | 15642808 | pMH2T7 | 
| 896871 | TM0047 | transposase | NP_227863 | 15642822 | pMH1 | 
| 896891 | TM0067 | 2-keto-3-deoxygluconate kinase | NP_227883 | 15642842 | pMH1 | 
| 896913 | TM0086 | virulence factor MviN-related protein | NP_227902 | 15642861 | pMH2T7 | 
| 896957 | TM0130 | hypothetical protein | NP_227946 | 15642905 | pMH1 | 
| 897018 | TM0178 | primosomal protein N' | NP_227993 | 15642952 | pMH2T7 | 
| 897336 | TM1024 | hypothetical protein | NP_228830 | 15643782 | pMH2T7 | 
| 896987 | TM0151 | hypothetical protein | NP_227966 | 15642925 | pMH2T7 | 
| 897025 | TM0179 | hypothetical protein | NP_227994 | 15642953 | pMH2T7 | 
| 896831 | TM0017 | pyruvate ferredoxin oxidoreductase, alpha subunit | NP_227833 | 15642792 | pMH1 | 
| 896873 | TM0049 | (Fe-S)-binding protein | NP_227865 | 15642824 | pMH1 | 
| 896894 | TM0069 | mannonate dehydratase | NP_227885 | 15642844 | pMH2T7 | 
| 896917 | TM0090 | hypothetical protein | NP_227906 | 15642865 | pMH1 | 
| 896961 | TM0134 | thioredoxin reductase | NP_227949 | 15642908 | pMH2T7 | 
| 897028 | TM0181 | hypothetical protein | NP_227996 | 15642955 | pMH2T7 | 
| 896832 | TM0018 | pyruvate ferredoxin oxidoreductase, beta subunit | NP_227834 | 15642793 | pMH1 | 
| 896857 | TM0036 | NTPase | NP_227852 | 15642811 | pMH2T7 | 
| 896874 | TM0050 | iron(II) transport protein A | NP_227866 | 15642825 | pMH1 | 
| 896895 | TM0070 | endo-1,4-beta-xylanase B | NP_227886 | 15642845 | pMH2T7 | 
| 896918 | TM0091 | hypothetical protein | NP_227907 | 15642866 | pMH1 | 
| 896962 | TM0135 | transposase | NP_227950 | 15642909 | pMH2T7 | 
| 896990 | TM0154 | hypothetical protein | NP_227969 | 15642928 | pMH2T7 | 
| 896835 | TM0020 | hypothetical protein | NP_227836 | 15642795 | pMH1 | 
| 896860 | TM0037 | hypothetical protein | NP_227853 | 15642812 | pMH2T7 | 
| 896877 | TM0053 | esterase | NP_227869 | 15642828 | pMH2T7 | 
| 896897 | TM0072 | peptide ABC transporter permease | NP_227888 | 15642847 | pMH1 | 
| 896919 | TM0092 | hypothetical protein | NP_227908 | 15642867 | pMH1 | 
| 896963 | TM0136 | hypothetical protein | NP_227951 | 15642910 | pMH2T7 | 
| 896991 | TM0155 | chorismate mutase | NP_227970 | 15642929 | pMH2T7 | 
| 898051 | TM1424 | Fe-hydrogenase, subunit gamma | NP_229224 | 15644175 | pMH2T7 | 
| 897937 | TM1608 | hypothetical protein | NP_229408 | 15644356 | pMH2T7 | 
| 897691 | TM1588 | hypothetical protein | NP_229388 | 15644336 | pMH2T7 | 
| 898059 | TM1416 | hypothetical protein | NP_229217 | 15644168 | pMH2T7 | 
| 897954 | TM1583 | hypothetical protein | NP_229383 | 15644331 | pMH2T7 | 
| 897376 | TM1555 | hypothetical protein | NP_229355 | 15644303 | pMH2T7 | 
| 897907 | TM1665 | hypothetical protein | NP_229465 | 15644413 | pMH2T7 | 
| 898637 | TM1127 | hypothetical protein | NP_228933 | 15643884 | pMH2T7 | 
| 898603 | TM0929 | hypothetical protein | NP_228737 | 15643691 | pMH2T7 | 
| 898437 | TM0769 | phosphomannomutase | NP_228578 | 15643532 | pMH2T7 | 
| 898654 | TM1111 | hypothetical protein | NP_228917 | 15643868 | pMH2T7 | 
| 898677 | TM1089 | TRK system potassium uptake protein TrkH | NP_228895 | 15643846 | pMH2T7 | 
| 898538 | TM0865 | hypothetical protein | NP_228674 | 15643628 | pMH2T7 | 
| 898447 | TM0779 | hypothetical protein | NP_228588 | 15643542 | pMH2T7 | 
| 897756 | TM0651 | hypothetical protein | NP_228460 | 15643416 | pMH2T7 | 
| 898525 | TM0853 | sensor histidine kinase | NP_228662 | 15643616 | pMH2T7 | 
| 898341 | TM0673 | basal-body rod modification protein FlgD | NP_228482 | 15643438 | pMH2T7 | 
| 898623 | TM1141 | cytochrome C biogenesis protein | NP_228947 | 15643898 | pMH2T7 | 
| 898498 | TM0828 | PfkB family sugar kinase | NP_228637 | 15643591 | pMH2T7 | 
| 897782 | TM0667 | hypothetical protein | NP_228476 | 15643432 | pMH2T7 | 
| 897677 | minC | septum formation inhibitor | NP_228853 | 15643805 | pMH2T7 | 
| 897741 | TM0640 | hypothetical protein | NP_228449 | 15643405 | pMH2T7 | 
| 897056 | TM1027 | hypothetical protein | NP_228833 | 15643785 | pMH2T7 | 
| 898657 | TM1108 | hypothetical protein | NP_228914 | 15643865 | pMH2T7 | 
| 897702 | TM1025 | hypothetical protein | NP_228831 | 15643783 | pMH2T7 | 
| 898722 | TM0976 | hypothetical protein | NP_228784 | 15643736 | pMH2T7 | 
| 897148 | TM1076 | hypothetical protein | NP_228882 | 15643834 | pMH2T7 | 
| 898646 | TM1118 | hypothetical protein | NP_228924 | 15643875 | pMH2T7 | 
| 897057 | TM1031 | glutaredoxin | NP_228837 | 15643789 | pMH2T7 | 
| 896821 | TM0994 | hypothetical protein | NP_228802 | 15643754 | pMH2T7 | 
| 898675 | TM1091 | hypothetical protein | NP_228897 | 15643848 | pMH2T7 | 
| 897513 | TM1056 | periplasmic divalent cation tolerance protein | NP_228862 | 15643814 | pMH2T7 | 
| 898576 | TM0902 | RNA polymerase sigma-28 factor | NP_228710 | 15643664 | pMH2T7 | 
| 898606 | TM0932 | hypothetical protein | NP_228740 | 15643694 | pMH2T7 | 
| 898605 | TM0931 | hypothetical protein | NP_228739 | 15643693 | pMH2T7 | 
| 898572 | TM0898 | hypothetical protein | NP_228706 | 15643660 | pMH2T7 | 
| 898571 | TM0897 | spoVS-related protein | NP_228705 | 15643659 | pMH2T7 | 
| 898569 | TM0895 | glycogen synthase | NP_228703 | 15643657 | pMH2T7 | 
| 898505 | TM0834 | hypothetical protein | NP_228643 | 15643597 | pMH2T7 | 
| 898697 | TM0960 | ribokinase | NP_228768 | 15643720 | pMH2T7 | 
| 898497 | TM0827 | ABC transporter ATP-binding protein | NP_228636 | 15643590 | pMH2T7 | 
| 897451 | TM0436 | alcohol dehydrogenase | NP_228246 | 15643202 | pMH2T7 | 
| 897478 | TM0452 | preprotein translocase SecE subunit | NP_228262 | 15643218 | pMH2T7 | 
| 897354 | TM0379 | NADH oxidase | NP_228190 | 15643146 | pMH2T7 | 
| 897291 | TM0336 | hypothetical protein | NP_228147 | 15643104 | pMH2T7 | 
| 897494 | TM0463 | lipoprotein signal peptidase | NP_228273 | 15643229 | pMH2T7 | 
| 898467 | TM0799 | bioY protein | NP_228608 | 15643562 | pMH2T7 | 
| 898378 | TM0711 | hypothetical protein | NP_228520 | 15643474 | pMH2T7 | 
| 898409 | TM0742 | serine/threonine protein phosphatase | NP_228551 | 15643505 | pMH2T7 | 
| 898408 | coaD | phosphopantetheine adenylyltransferase | NP_228550 | 15643504 | pMH2T7 | 
| 898390 | TM0723 | hypothetical protein | NP_228532 | 15643486 | pMH2T7 | 
| 898404 | TM0737 | hypothetical protein | NP_228546 | 15643500 | pMH2T7 | 
| 897750 | TM0645 | NH(3)-dependent NAD(+) synthetase | NP_228454 | 15643410 | pMH2T7 | 
| 898428 | TM0760 | lipopolysaccharide biosynthesis protein | NP_228569 | 15643523 | pMH2T7 | 
| 897940 | TM1602 | biotin repressor family transcriptional regulator | NP_229402 | 15644350 | pMH2T7 | 
| 897671 | TM1617 | hypothetical protein | NP_229417 | 15644365 | pMH2T7 | 
| 897285 | TM1708 | hypothetical protein | NP_229508 | 15644456 | pMH2T7 | 
| 897450 | TM1599 | hypothetical protein | NP_229399 | 15644347 | pMH2T7 | 
| 897526 | rpmI | 50S ribosomal protein L35 | NP_229391 | 15644339 | pMH2T7 | 
| 897891 | TM1695 | hypothetical protein | NP_229495 | 15644443 | pMH2T7 | 
| 897900 | TM1679 | hypothetical protein | NP_229479 | 15644427 | pMH2T7 | 
| 896901 | rpsT | 30S ribosomal protein S20 | NP_229457 | 15644405 | pMH2T7 | 
| 897955 | TM1581 | hypothetical protein | NP_229381 | 15644329 | pMH2T7 | 
| 897965 | TM1562 | hypothetical protein | NP_229362 | 15644310 | pMH2T7 | 
| 897931 | TM1620 | hypothetical protein | NP_229420 | 15644368 | pMH2T7 | 
| 897957 | TM1577 | hypothetical protein | NP_229377 | 15644325 | pMH2T7 | 
| 897233 | TM1718 | ribulose-phosphate 3-epimerase | NP_229517 | 15644465 | pMH1 | 
| 897804 | TM1860 | hypothetical protein | NP_229656 | 15644603 | pMH1 | 
| 897619 | TM1832 | transposase | NP_229629 | 15644576 | pMH1 | 
| 897861 | TM1755 | phosphate butyryltransferase | NP_229553 | 15644501 | pMH1 | 
| 897173 | TM1734 | phosphate transport system regulator PhoU | NP_229532 | 15644480 | pMH1 | 
| 898021 | TM1455 | hypothetical protein | NP_229254 | 15644204 | pMH1 | 
| 897335 | rplD | 50S ribosomal protein L4 | NP_229299 | 15644247 | pMH1 | 
| 898129 | gltX | glutamyl-tRNA synthetase | NP_229152 | 15644103 | pMH1 | 
| 897340 | rplF | 50S ribosomal protein L6 | NP_229285 | 15644233 | pMH1 | 
| 898244 | TM1240 | GTP-dependent nucleic acid-binding protein EngD | NP_229045 | 15643996 | pMH1 | 
| 898648 | rpmD | 50S ribosomal protein L30 | NP_229282 | 15644230 | pMH1 | 
| 897928 | TM1626 | peptidyl-tRNA hydrolase | NP_229426 | 15644374 | pMH1 | 
| 897640 | TM1574 | tRNA pseudouridine synthase ACD | NP_229374 | 15644322 | pMH1 | 
| 898065 | TM1411 | helicase-related protein | NP_229212 | 15644163 | pMH1 | 
| 898078 | TM1398 | undecaprenyl pyrophosphate synthase | NP_229199 | 15644150 | pMH1 | 
| 897805 | TM1858 | recX protein | NP_229654 | 15644601 | pMH1 | 
| 897847 | TM1776 | ferric uptake regulation protein | NP_229573 | 15644521 | pMH1 | 
| 898482 | TM0814 | N-acetylglucosamine-6-phosphate deacetylase | NP_228623 | 15643577 | pMH1 | 
| 897780 | TM0665 | cysteine synthase | NP_228474 | 15643430 | pMH1 | 
| 898473 | TM0805 | lipophilic protein | NP_228614 | 15643568 | pMH1 | 
| 897765 | TM0656 | hypothetical protein | NP_228465 | 15643421 | pMH1 | 
| 897701 | TM1012 | hypothetical protein | NP_228818 | 15643770 | pMH1 | 
| 898610 | TM0936 | hypothetical protein | NP_228744 | 15643698 | pMH1 | 
| 898439 | TM0771 | DNA polymerase III, gamma subunit-related protein | NP_228580 | 15643534 | pMH1 | 
| 898725 | TM0979 | hypothetical protein | NP_228787 | 15643739 | pMH1 | 
| 898017 | TM1461 | hypothetical protein | NP_229260 | 15644210 | pMH1 | 
| 898317 | TM1169 | 3-oxoacyl-ACP reductase | NP_228974 | 15643925 | pMH1 | 
| 898022 | rplM | 50S ribosomal protein L13 | NP_229253 | 15644203 | pMH1 | 
| 898027 | TM1449 | hypothetical protein | NP_229248 | 15644198 | pMH1 | 
| 898224 | TM1259 | phosphate regulon transcriptional regulatory protein PhoB | NP_229064 | 15644015 | pMH1 | 
| 898320 | TM1166 | oxygen-independent coproporphyrinogen III oxidase | NP_228972 | 15643923 | pMH1 | 
| 898626 | TM1138 | branched chain amino acid ABC transporter ATP-binding protein | NP_228944 | 15643895 | pMH1 | 
| 898130 | TM1350 | lipase | NP_229151 | 15644102 | pMH1 | 
| 898330 | TM1156 | hypothetical protein | NP_228962 | 15643913 | pMH1 | 
| 898290 | TM1194 | peptide ABC transporter ATP-binding protein | NP_228999 | 15643950 | pMH1 | 
| 898259 | TM1225 | hypothetical protein | NP_229030 | 15643981 | pMH1 | 
| 898632 | TM1132 | moxR protein | NP_228938 | 15643889 | pMH1 | 
| 898633 | TM1131 | aminotransferase | NP_228937 | 15643888 | pMH1 | 
| 898265 | TM1219 | peptide ABC transporter ATP-binding protein | NP_229024 | 15643975 | pMH1 | 
| 898212 | TM1271 | type IV pilin-related protein | NP_229076 | 15644027 | pMH1 | 
| 898634 | TM1130 | phosphate butyryltransferase | NP_228936 | 15643887 | pMH1 | 
| 897094 | TM1086 | hypothetical protein | NP_228892 | 15643844 | pMH1 | 
| 897149 | TM1070 | hypothetical protein | NP_228876 | 15643828 | pMH1 | 
| 898636 | TM1128 | ferritin | NP_228934 | 15643885 | pMH1 | 
| 898658 | TM1107 | hypothetical protein | NP_228913 | 15643864 | pMH1 | 
| 897569 | TM1083 | hypothetical protein | NP_228889 | 15643841 | pMH1 | 
| 898619 | TM1145 | hypothetical protein | NP_228951 | 15643902 | pMH1 | 
| 897267 | TM1004 | hypothetical protein | NP_228812 | 15643764 | pMH1 | 
| 898727 | TM0981 | hypothetical protein | NP_228789 | 15643741 | pMH1 | 
| 898726 | TM0980 | hypothetical protein | NP_228788 | 15643740 | pMH1 | 
| 898661 | TM1104 | hypothetical protein | NP_228910 | 15643861 | pMH1 | 
| 897426 | TM1080 | sugar-phosphate isomerase | NP_228886 | 15643838 | pMH1 | 
| 896839 | TM1002 | hypothetical protein | NP_228810 | 15643762 | pMH1 | 
| 897252 | TM1001 | hypothetical protein | NP_228809 | 15643761 | pMH1 | 
| 898644 | TM1120 | glycerol-3-phosphate ABC transporter substrate-binding protein | NP_228926 | 15643877 | pMH1 | 
| 896982 | TM0996 | hypothetical protein | NP_228804 | 15643756 | pMH1 | 
| 898720 | TM0974 | hypothetical protein | NP_228782 | 15643734 | pMH1 | 
| 898645 | TM1119 | hypothetical protein | NP_228925 | 15643876 | pMH1 | 
| 897249 | TM1033 | mannose-1-phosphate guanylyltransferase | NP_228839 | 15643791 | pMH1 | 
| 897083 | TM1075 | hypothetical protein | NP_228881 | 15643833 | pMH1 | 
| 897092 | TM1030 | TetR family transcriptional regulator | NP_228836 | 15643788 | pMH1 | 
| 897386 | flgI | flagellar basal body P-ring biosynthesis protein FlgA | NP_229339 | 15644287 | pMH1 | 
| 898001 | rplN | 50S ribosomal protein L14 | NP_229290 | 15644238 | pMH1 | 
| 897966 | TM1560 | serine cycle enzyme | NP_229360 | 15644308 | pMH1 | 
| 898035 | TM1440 | translation initiation factor eIF-2B alpha subunit-related | NP_229239 | 15644190 | pMH1 | 
| 897566 | TM1559 | deoxyribose-phosphate aldolase | NP_229359 | 15644307 | pMH1 | 
| 897387 | TM1515 | ferric uptake regulation protein | NP_229315 | 15644263 | pMH1 | 
| 897353 | rplX | 50S ribosomal protein L24 | NP_229289 | 15644237 | pMH1 | 
| 898122 | TM1358 | hypothetical protein | NP_229159 | 15644110 | pMH1 | 
| 898056 | TM1419 | myo-inositol-1-phosphate synthase | NP_229219 | 15644170 | pMH1 | 
| 897989 | TM1514 | hypothetical protein | NP_229314 | 15644262 | pMH1 | 
| 897063 | TM1472 | DNA-directed RNA polymerase subunit alpha | NP_229272 | 15644221 | pMH1 | 
| 898023 | rpsI | 30S ribosomal protein S9 | NP_229252 | 15644202 | pMH1 | 
| 897990 | TM1512 | sun protein | NP_229312 | 15644260 | pMH1 | 
| 897343 | radC | DNA repair protein RadC | NP_229357 | 15644305 | pMH1 | 
| 898041 | TM1434 | hypothetical protein | NP_229234 | 15644185 | pMH1 | 
| 898030 | engA | GTP-binding protein EngA | NP_229245 | 15644195 | pMH1 | 
| 897968 | TM1556 | Maf-like protein | NP_229356 | 15644304 | pMH1 | 
| 898042 | TM1433 | oxidoreductase | NP_229233 | 15644184 | pMH1 | 
| 898091 | coaE | dephospho-CoA kinase | NP_229188 | 15644139 | pMH1 | 
| 898008 | TM1478 | methionine aminopeptidase | NP_229278 | 15644226 | pMH1 | 
| 898093 | TM1385 | glucose-6-phosphate isomerase | NP_229186 | 15644137 | pMH1 | 
| 897993 | TM1506 | hypothetical protein | NP_229306 | 15644254 | pMH1 | 
| 898092 | TM1386 | hypothetical protein | NP_229187 | 15644138 | pMH1 | 
| 898013 | TM1469 | glucokinase | NP_229269 | 15644218 | pMH1 | 
| 898674 | rplV | 50S ribosomal protein L22 | NP_229295 | 15644243 | pMH1 | 
| 896983 | TM1464 | hypothetical protein | NP_229264 | 15644213 | pMH1 | 
| 898018 | TM1459 | hypothetical protein | NP_229258 | 15644208 | pMH1 | 
| 897980 | TM1532 | oxidoreductase FixC | NP_229332 | 15644280 | pMH1 | 
| 897247 | TM0311 | hypothetical protein | NP_228123 | 15643080 | pMH1 | 
| 897219 | TM0294 | gamma-glutamyl kinase | NP_228106 | 15643063 | pMH1 | 
| 897120 | TM0223 | hypothetical protein | NP_228038 | 15642996 | pMH1 | 
| 897164 | TM0256 | hypothetical protein | NP_228070 | 15643027 | pMH1 | 
| 897216 | leuD | 3-isopropylmalate dehydratase small subunit | NP_228104 | 15643061 | pMH1 | 
| 897188 | TM0273 | fructose-bisphosphate aldolase | NP_228086 | 15643043 | pMH1 | 
| 897161 | TM0252 | glutamyl tRNA-Gln amidotransferase subunit C | NP_228066 | 15643024 | pMH1 | 
| 897110 | TM0219 | flagellar export/assembly protein | NP_228034 | 15642992 | pMH1 | 
| 897073 | TM0203 | ABC transporter permease | NP_228018 | 15642976 | pMH1 | 
| 897215 | TM0291 | 3-isopropylmalate dehydratase large subunit | NP_228103 | 15643060 | pMH1 | 
| 897105 | TM0218 | flagellum-specific ATP synthase | NP_228033 | 15642991 | pMH1 | 
| 897265 | TM0322 | ABC transporter substrate-binding protein | NP_228134 | 15643091 | pMH1 | 
| 897234 | TM0304 | peptide ABC transporter ATP-binding protein | NP_228116 | 15643073 | pMH1 | 
| 897184 | TM0270 | hypothetical protein | NP_228083 | 15643040 | pMH1 | 
| 897101 | glyQ | glycyl-tRNA synthetase subunit alpha | NP_228031 | 15642989 | pMH1 | 
| 897070 | TM0200 | DNA integrity scanning protein DisA | NP_228015 | 15642973 | pMH1 | 
| 897263 | TM0321 | hypothetical protein | NP_228133 | 15643090 | pMH1 | 
| 897183 | TM0269 | hypothetical protein | NP_228082 | 15643039 | pMH1 | 
| 897153 | TM0246 | hypothetical protein | NP_228060 | 15643018 | pMH1 | 
| 897132 | TM0233 | cell cycle protein FtsW | NP_228047 | 15643005 | pMH1 | 
| 897201 | TM0283 | L-ribulose-5-phosphate 4-epimerase | NP_228095 | 15643052 | pMH1 | 
| 897177 | TM0266 | DNA-binding protein, HU | NP_228079 | 15643036 | pMH1 | 
| 897147 | TM0245 | Na-translocating NADH-quinone reductase, Nqr2 subunit | NP_228059 | 15643017 | pMH1 | 
| 897054 | TM0194 | ABC transporter ATP-binding protein | NP_228009 | 15642967 | pMH1 | 
| 897146 | TM0244 | electron transport complex protein | NP_228058 | 15643016 | pMH1 | 
| 897090 | TM0212 | glycine cleavage system protein H | NP_228027 | 15642985 | pMH1 | 
| 897052 | TM0193 | hypothetical protein | NP_228008 | 15642966 | pMH1 | 
| 897260 | TM0318 | ubiquinone/menaquinone biosynthesis-related protein | NP_228130 | 15643087 | pMH1 | 
| 897224 | TM0299 | LacI family transcription regulator | NP_228111 | 15643068 | pMH1 | 
| 897172 | TM0262 | DNA polymerase III, beta subunit | NP_228075 | 15643032 | pMH1 | 
| 897085 | gcvT | glycine cleavage system aminomethyltransferase T | NP_228026 | 15642984 | pMH1 | 
| 897257 | TM0316 | hypothetical protein | NP_228128<
                
            
            
         There are no products listed under this category.  |