Explore

Explore

Explora Plasmids and Lentivectors of Annotated proteins

 

Related Genes

 

Structrural Annotation Protein from cDNA clone

researcher-performing-biomedical-experiments-in-bi-2021-08-29-01-06-37-utc.jpg

 

  1. PDB reference: chorismate mutase/prephenate dehydrogenase, 2pv7
  2. 3D view

bacterial-culture-plate-2021-08-29-01-20-34-utc.jpg

topsanatnih-11-728.jpg

 

Topsan Sequencing Primers

 

  • We have primers to sequence verify gene inserts for most of the plasmids avialable in the TOPSAN repository. 
  • Not used for Sanger or Next Generation sequencing

lab-research-2021-09-24-03-29-08-utc.jpg

ABM's Sequencing Primers


Primer Name
Primer Sequence

 

Primer Name
                                           Primer Sequence
AttP2 
                                          CAGGAAACAGCTATGAC
M13F
                                              GTAAAACGACGGCCAGT
M13R
                                             CAGGAAACAGCTATGACC
NAP138R
                                             TGTTTCGCCATTTATCACCTTC
NAP150
                                             CCCATTGTATGGGATCTGATC
T7
                                             TAATACGACTCACTATAG
T7 terminator
                                              GCTAGTTATTGCTCAGCGG
 
 
 

Topsan Accesssion Numbers

 

 

Gene ID Gene Symbol Gene Name Reference Sequence Genbank Accession Reference Sequence GI Vector
896836 TM0021 hypothetical protein NP_227837 15642796 pMH1
896861 TM0038 6-pyruvoyl tetrahydrobiopterin synthase NP_227854 15642813 pMH1
896878 TM0054 hypothetical protein NP_227870 15642829 pMH1
896898 TM0073 peptide ABC transporter permease NP_227889 15642848 pMH1
896920 TM0093 hypothetical protein NP_227909 15642868 pMH1
896968 TM0138 tryptophan synthase subunit beta NP_227953 15642912 pMH2T7
896993 TM0156 alkaline phosphatase NP_227971 15642930 pMH2T7
896810 TM0002 hypothetical protein NP_227818 15642777 pMH1
896838 TM0023 methyl-accepting chemotaxis protein NP_227839 15642798 pMH2T7
896879 TM0055 alpha-glucuronidase NP_227871 15642830 pMH2T7
896900 TM0075 peptide ABC transporter ATP-binding protein NP_227891 15642850 pMH1
896922 TM0095 hypothetical protein NP_227911 15642870 pMH1
896969 TM0139 N-(5'-phosphoribosyl)anthranilate isomerase NP_227954 15642913 pMH2T7
896995 TM0157 actinorhodin polyketide dimerase NP_227972 15642931 pMH2T7
896817 TM0008 hypothetical protein NP_227824 15642783 pMH1
896840 TM0024 laminarinase NP_227840 15642799 pMH2T7
896864 TM0040 dihydropteroate synthase NP_227856 15642815 pMH2T7
896880 TM0056 peptide ABC transporter substrate-binding protein NP_227872 15642831 pMH2T7
896903 TM0077 acetyl xylan esterase NP_227893 15642852 pMH1
896970 TM0140 indole-3-glycerol phosphate synthase NP_227955 15642914 pMH1
897005 TM0166 folylpolyglutamate synthase/dihydrofolate synthase NP_227981 15642940 pMH2T7
896818 TM0009 hypothetical protein NP_227825 15642784 pMH1
896866 TM0042 aminopeptidase NP_227858 15642817 pMH1
896883 TM0059 peptide ABC transporter permease NP_227875 15642834 pMH1
896905 TM0079 iron(III) ABC transporter permease NP_227895 15642854 pMH2T7
896973 TM0143 response regulator NP_227958 15642917 pMH1
897009 TM0170 hypothetical protein NP_227985 15642944 pMH2T7
896823 TM0012 NADP-reducing hydrogenase, subunit A NP_227828 15642787 pMH2T7
896845 TM0027 peptide ABC transporter ATP-binding protein NP_227843 15642802 pMH1
896884 TM0060 peptide ABC transporter permease NP_227876 15642835 pMH1
896907 TM0080 iron ABC transporter substrate-binding protein NP_227896 15642855 pMH1
896950 TM0123 zinc ABC transporter substrate-binding protein NP_227939 15642898 pMH2T7
896980 TM0147 hypothetical protein NP_227962 15642921 pMH2T7
897011 TM0172 S-adenosyl-L-homocysteine hydrolase NP_227987 15642946 pMH1
896848 TM0028 peptide ABC transporter ATP-binding protein NP_227844 15642803 pMH1
896869 TM0045 hypothetical protein NP_227861 15642820 pMH1
896888 TM0064 glucuronate isomerase NP_227880 15642839 pMH2T7
896909 TM0082 flagellar hook-associated protein 3 NP_227898 15642857 pMH1
896953 TM0126 response regulator NP_227942 15642901 pMH2T7
897016 TM0176 hypothetical protein NP_227991 15642950 pMH2T7
896826 TM0014 methyl-accepting chemotaxis protein NP_227830 15642789 pMH1
896852 TM0031 peptide ABC transporter substrate-binding protein NP_227847 15642806 pMH2T7
896870 TM0046 hypothetical protein NP_227862 15642821 pMH1
896890 TM0066 2-dehydro-3-deoxyphosphogluconate aldolase/4-hydroxy-2-oxoglutarate aldolase NP_227882 15642841 pMH2T7
896911 TM0084 hypothetical protein NP_227900 15642859 pMH2T7
896955 TM0128 oxaloacetate decarboxylase NP_227944 15642903 pMH2T7
896984 TM0149 glycerol-3-phosphate acyltransferase PlsX NP_227964 15642923 pMH2T7
897017 TM0177 hypothetical protein NP_227992 15642951 pMH2T7
896829 TM0015 pyruvate ferredoxin oxidoreductase, gamma subunit NP_227831 15642790 pMH1
896854 TM0033 hypothetical protein NP_227849 15642808 pMH2T7
896871 TM0047 transposase NP_227863 15642822 pMH1
896891 TM0067 2-keto-3-deoxygluconate kinase NP_227883 15642842 pMH1
896913 TM0086 virulence factor MviN-related protein NP_227902 15642861 pMH2T7
896957 TM0130 hypothetical protein NP_227946 15642905 pMH1
897018 TM0178 primosomal protein N' NP_227993 15642952 pMH2T7
897336 TM1024 hypothetical protein NP_228830 15643782 pMH2T7
896987 TM0151 hypothetical protein NP_227966 15642925 pMH2T7
897025 TM0179 hypothetical protein NP_227994 15642953 pMH2T7
896831 TM0017 pyruvate ferredoxin oxidoreductase, alpha subunit NP_227833 15642792 pMH1
896873 TM0049 (Fe-S)-binding protein NP_227865 15642824 pMH1
896894 TM0069 mannonate dehydratase NP_227885 15642844 pMH2T7
896917 TM0090 hypothetical protein NP_227906 15642865 pMH1
896961 TM0134 thioredoxin reductase NP_227949 15642908 pMH2T7
897028 TM0181 hypothetical protein NP_227996 15642955 pMH2T7
896832 TM0018 pyruvate ferredoxin oxidoreductase, beta subunit NP_227834 15642793 pMH1
896857 TM0036 NTPase NP_227852 15642811 pMH2T7
896874 TM0050 iron(II) transport protein A NP_227866 15642825 pMH1
896895 TM0070 endo-1,4-beta-xylanase B NP_227886 15642845 pMH2T7
896918 TM0091 hypothetical protein NP_227907 15642866 pMH1
896962 TM0135 transposase NP_227950 15642909 pMH2T7
896990 TM0154 hypothetical protein NP_227969 15642928 pMH2T7
896835 TM0020 hypothetical protein NP_227836 15642795 pMH1
896860 TM0037 hypothetical protein NP_227853 15642812 pMH2T7
896877 TM0053 esterase NP_227869 15642828 pMH2T7
896897 TM0072 peptide ABC transporter permease NP_227888 15642847 pMH1
896919 TM0092 hypothetical protein NP_227908 15642867 pMH1
896963 TM0136 hypothetical protein NP_227951 15642910 pMH2T7
896991 TM0155 chorismate mutase NP_227970 15642929 pMH2T7
898051 TM1424 Fe-hydrogenase, subunit gamma NP_229224 15644175 pMH2T7
897937 TM1608 hypothetical protein NP_229408 15644356 pMH2T7
897691 TM1588 hypothetical protein NP_229388 15644336 pMH2T7
898059 TM1416 hypothetical protein NP_229217 15644168 pMH2T7
897954 TM1583 hypothetical protein NP_229383 15644331 pMH2T7
897376 TM1555 hypothetical protein NP_229355 15644303 pMH2T7
897907 TM1665 hypothetical protein NP_229465 15644413 pMH2T7
898637 TM1127 hypothetical protein NP_228933 15643884 pMH2T7
898603 TM0929 hypothetical protein NP_228737 15643691 pMH2T7
898437 TM0769 phosphomannomutase NP_228578 15643532 pMH2T7
898654 TM1111 hypothetical protein NP_228917 15643868 pMH2T7
898677 TM1089 TRK system potassium uptake protein TrkH NP_228895 15643846 pMH2T7
898538 TM0865 hypothetical protein NP_228674 15643628 pMH2T7
898447 TM0779 hypothetical protein NP_228588 15643542 pMH2T7
897756 TM0651 hypothetical protein NP_228460 15643416 pMH2T7
898525 TM0853 sensor histidine kinase NP_228662 15643616 pMH2T7
898341 TM0673 basal-body rod modification protein FlgD NP_228482 15643438 pMH2T7
898623 TM1141 cytochrome C biogenesis protein NP_228947 15643898 pMH2T7
898498 TM0828 PfkB family sugar kinase NP_228637 15643591 pMH2T7
897782 TM0667 hypothetical protein NP_228476 15643432 pMH2T7
897677 minC septum formation inhibitor NP_228853 15643805 pMH2T7
897741 TM0640 hypothetical protein NP_228449 15643405 pMH2T7
897056 TM1027 hypothetical protein NP_228833 15643785 pMH2T7
898657 TM1108 hypothetical protein NP_228914 15643865 pMH2T7
897702 TM1025 hypothetical protein NP_228831 15643783 pMH2T7
898722 TM0976 hypothetical protein NP_228784 15643736 pMH2T7
897148 TM1076 hypothetical protein NP_228882 15643834 pMH2T7
898646 TM1118 hypothetical protein NP_228924 15643875 pMH2T7
897057 TM1031 glutaredoxin NP_228837 15643789 pMH2T7
896821 TM0994 hypothetical protein NP_228802 15643754 pMH2T7
898675 TM1091 hypothetical protein NP_228897 15643848 pMH2T7
897513 TM1056 periplasmic divalent cation tolerance protein NP_228862 15643814 pMH2T7
898576 TM0902 RNA polymerase sigma-28 factor NP_228710 15643664 pMH2T7
898606 TM0932 hypothetical protein NP_228740 15643694 pMH2T7
898605 TM0931 hypothetical protein NP_228739 15643693 pMH2T7
898572 TM0898 hypothetical protein NP_228706 15643660 pMH2T7
898571 TM0897 spoVS-related protein NP_228705 15643659 pMH2T7
898569 TM0895 glycogen synthase NP_228703 15643657 pMH2T7
898505 TM0834 hypothetical protein NP_228643 15643597 pMH2T7
898697 TM0960 ribokinase NP_228768 15643720 pMH2T7
898497 TM0827 ABC transporter ATP-binding protein NP_228636 15643590 pMH2T7
897451 TM0436 alcohol dehydrogenase NP_228246 15643202 pMH2T7
897478 TM0452 preprotein translocase SecE subunit NP_228262 15643218 pMH2T7
897354 TM0379 NADH oxidase NP_228190 15643146 pMH2T7
897291 TM0336 hypothetical protein NP_228147 15643104 pMH2T7
897494 TM0463 lipoprotein signal peptidase NP_228273 15643229 pMH2T7
898467 TM0799 bioY protein NP_228608 15643562 pMH2T7
898378 TM0711 hypothetical protein NP_228520 15643474 pMH2T7
898409 TM0742 serine/threonine protein phosphatase NP_228551 15643505 pMH2T7
898408 coaD phosphopantetheine adenylyltransferase NP_228550 15643504 pMH2T7
898390 TM0723 hypothetical protein NP_228532 15643486 pMH2T7
898404 TM0737 hypothetical protein NP_228546 15643500 pMH2T7
897750 TM0645 NH(3)-dependent NAD(+) synthetase NP_228454 15643410 pMH2T7
898428 TM0760 lipopolysaccharide biosynthesis protein NP_228569 15643523 pMH2T7
897940 TM1602 biotin repressor family transcriptional regulator NP_229402 15644350 pMH2T7
897671 TM1617 hypothetical protein NP_229417 15644365 pMH2T7
897285 TM1708 hypothetical protein NP_229508 15644456 pMH2T7
897450 TM1599 hypothetical protein NP_229399 15644347 pMH2T7
897526 rpmI 50S ribosomal protein L35 NP_229391 15644339 pMH2T7
897891 TM1695 hypothetical protein NP_229495 15644443 pMH2T7
897900 TM1679 hypothetical protein NP_229479 15644427 pMH2T7
896901 rpsT 30S ribosomal protein S20 NP_229457 15644405 pMH2T7
897955 TM1581 hypothetical protein NP_229381 15644329 pMH2T7
897965 TM1562 hypothetical protein NP_229362 15644310 pMH2T7
897931 TM1620 hypothetical protein NP_229420 15644368 pMH2T7
897957 TM1577 hypothetical protein NP_229377 15644325 pMH2T7
897233 TM1718 ribulose-phosphate 3-epimerase NP_229517 15644465 pMH1
897804 TM1860 hypothetical protein NP_229656 15644603 pMH1
897619 TM1832 transposase NP_229629 15644576 pMH1
897861 TM1755 phosphate butyryltransferase NP_229553 15644501 pMH1
897173 TM1734 phosphate transport system regulator PhoU NP_229532 15644480 pMH1
898021 TM1455 hypothetical protein NP_229254 15644204 pMH1
897335 rplD 50S ribosomal protein L4 NP_229299 15644247 pMH1
898129 gltX glutamyl-tRNA synthetase NP_229152 15644103 pMH1
897340 rplF 50S ribosomal protein L6 NP_229285 15644233 pMH1
898244 TM1240 GTP-dependent nucleic acid-binding protein EngD NP_229045 15643996 pMH1
898648 rpmD 50S ribosomal protein L30 NP_229282 15644230 pMH1
897928 TM1626 peptidyl-tRNA hydrolase NP_229426 15644374 pMH1
897640 TM1574 tRNA pseudouridine synthase ACD NP_229374 15644322 pMH1
898065 TM1411 helicase-related protein NP_229212 15644163 pMH1
898078 TM1398 undecaprenyl pyrophosphate synthase NP_229199 15644150 pMH1
897805 TM1858 recX protein NP_229654 15644601 pMH1
897847 TM1776 ferric uptake regulation protein NP_229573 15644521 pMH1
898482 TM0814 N-acetylglucosamine-6-phosphate deacetylase NP_228623 15643577 pMH1
897780 TM0665 cysteine synthase NP_228474 15643430 pMH1
898473 TM0805 lipophilic protein NP_228614 15643568 pMH1
897765 TM0656 hypothetical protein NP_228465 15643421 pMH1
897701 TM1012 hypothetical protein NP_228818 15643770 pMH1
898610 TM0936 hypothetical protein NP_228744 15643698 pMH1
898439 TM0771 DNA polymerase III, gamma subunit-related protein NP_228580 15643534 pMH1
898725 TM0979 hypothetical protein NP_228787 15643739 pMH1
898017 TM1461 hypothetical protein NP_229260 15644210 pMH1
898317 TM1169 3-oxoacyl-ACP reductase NP_228974 15643925 pMH1
898022 rplM 50S ribosomal protein L13 NP_229253 15644203 pMH1
898027 TM1449 hypothetical protein NP_229248 15644198 pMH1
898224 TM1259 phosphate regulon transcriptional regulatory protein PhoB NP_229064 15644015 pMH1
898320 TM1166 oxygen-independent coproporphyrinogen III oxidase NP_228972 15643923 pMH1
898626 TM1138 branched chain amino acid ABC transporter ATP-binding protein NP_228944 15643895 pMH1
898130 TM1350 lipase NP_229151 15644102 pMH1
898330 TM1156 hypothetical protein NP_228962 15643913 pMH1
898290 TM1194 peptide ABC transporter ATP-binding protein NP_228999 15643950 pMH1
898259 TM1225 hypothetical protein NP_229030 15643981 pMH1
898632 TM1132 moxR protein NP_228938 15643889 pMH1
898633 TM1131 aminotransferase NP_228937 15643888 pMH1
898265 TM1219 peptide ABC transporter ATP-binding protein NP_229024 15643975 pMH1
898212 TM1271 type IV pilin-related protein NP_229076 15644027 pMH1
898634 TM1130 phosphate butyryltransferase NP_228936 15643887 pMH1
897094 TM1086 hypothetical protein NP_228892 15643844 pMH1
897149 TM1070 hypothetical protein NP_228876 15643828 pMH1
898636 TM1128 ferritin NP_228934 15643885 pMH1
898658 TM1107 hypothetical protein NP_228913 15643864 pMH1
897569 TM1083 hypothetical protein NP_228889 15643841 pMH1
898619 TM1145 hypothetical protein NP_228951 15643902 pMH1
897267 TM1004 hypothetical protein NP_228812 15643764 pMH1
898727 TM0981 hypothetical protein NP_228789 15643741 pMH1
898726 TM0980 hypothetical protein NP_228788 15643740 pMH1
898661 TM1104 hypothetical protein NP_228910 15643861 pMH1
897426 TM1080 sugar-phosphate isomerase NP_228886 15643838 pMH1
896839 TM1002 hypothetical protein NP_228810 15643762 pMH1
897252 TM1001 hypothetical protein NP_228809 15643761 pMH1
898644 TM1120 glycerol-3-phosphate ABC transporter substrate-binding protein NP_228926 15643877 pMH1
896982 TM0996 hypothetical protein NP_228804 15643756 pMH1
898720 TM0974 hypothetical protein NP_228782 15643734 pMH1
898645 TM1119 hypothetical protein NP_228925 15643876 pMH1
897249 TM1033 mannose-1-phosphate guanylyltransferase NP_228839 15643791 pMH1
897083 TM1075 hypothetical protein NP_228881 15643833 pMH1
897092 TM1030 TetR family transcriptional regulator NP_228836 15643788 pMH1
897386 flgI flagellar basal body P-ring biosynthesis protein FlgA NP_229339 15644287 pMH1
898001 rplN 50S ribosomal protein L14 NP_229290 15644238 pMH1
897966 TM1560 serine cycle enzyme NP_229360 15644308 pMH1
898035 TM1440 translation initiation factor eIF-2B alpha subunit-related NP_229239 15644190 pMH1
897566 TM1559 deoxyribose-phosphate aldolase NP_229359 15644307 pMH1
897387 TM1515 ferric uptake regulation protein NP_229315 15644263 pMH1
897353 rplX 50S ribosomal protein L24 NP_229289 15644237 pMH1
898122 TM1358 hypothetical protein NP_229159 15644110 pMH1
898056 TM1419 myo-inositol-1-phosphate synthase NP_229219 15644170 pMH1
897989 TM1514 hypothetical protein NP_229314 15644262 pMH1
897063 TM1472 DNA-directed RNA polymerase subunit alpha NP_229272 15644221 pMH1
898023 rpsI 30S ribosomal protein S9 NP_229252 15644202 pMH1
897990 TM1512 sun protein NP_229312 15644260 pMH1
897343 radC DNA repair protein RadC NP_229357 15644305 pMH1
898041 TM1434 hypothetical protein NP_229234 15644185 pMH1
898030 engA GTP-binding protein EngA NP_229245 15644195 pMH1
897968 TM1556 Maf-like protein NP_229356 15644304 pMH1
898042 TM1433 oxidoreductase NP_229233 15644184 pMH1
898091 coaE dephospho-CoA kinase NP_229188 15644139 pMH1
898008 TM1478 methionine aminopeptidase NP_229278 15644226 pMH1
898093 TM1385 glucose-6-phosphate isomerase NP_229186 15644137 pMH1
897993 TM1506 hypothetical protein NP_229306 15644254 pMH1
898092 TM1386 hypothetical protein NP_229187 15644138 pMH1
898013 TM1469 glucokinase NP_229269 15644218 pMH1
898674 rplV 50S ribosomal protein L22 NP_229295 15644243 pMH1
896983 TM1464 hypothetical protein NP_229264 15644213 pMH1
898018 TM1459 hypothetical protein NP_229258 15644208 pMH1
897980 TM1532 oxidoreductase FixC NP_229332 15644280 pMH1
897247 TM0311 hypothetical protein NP_228123 15643080 pMH1
897219 TM0294 gamma-glutamyl kinase NP_228106 15643063 pMH1
897120 TM0223 hypothetical protein NP_228038 15642996 pMH1
897164 TM0256 hypothetical protein NP_228070 15643027 pMH1
897216 leuD 3-isopropylmalate dehydratase small subunit NP_228104 15643061 pMH1
897188 TM0273 fructose-bisphosphate aldolase NP_228086 15643043 pMH1
897161 TM0252 glutamyl tRNA-Gln amidotransferase subunit C NP_228066 15643024 pMH1
897110 TM0219 flagellar export/assembly protein NP_228034 15642992 pMH1
897073 TM0203 ABC transporter permease NP_228018 15642976 pMH1
897215 TM0291 3-isopropylmalate dehydratase large subunit NP_228103 15643060 pMH1
897105 TM0218 flagellum-specific ATP synthase NP_228033 15642991 pMH1
897265 TM0322 ABC transporter substrate-binding protein NP_228134 15643091 pMH1
897234 TM0304 peptide ABC transporter ATP-binding protein NP_228116 15643073 pMH1
897184 TM0270 hypothetical protein NP_228083 15643040 pMH1
897101 glyQ glycyl-tRNA synthetase subunit alpha NP_228031 15642989 pMH1
897070 TM0200 DNA integrity scanning protein DisA NP_228015 15642973 pMH1
897263 TM0321 hypothetical protein NP_228133 15643090 pMH1
897183 TM0269 hypothetical protein NP_228082 15643039 pMH1
897153 TM0246 hypothetical protein NP_228060 15643018 pMH1
897132 TM0233 cell cycle protein FtsW NP_228047 15643005 pMH1
897201 TM0283 L-ribulose-5-phosphate 4-epimerase NP_228095 15643052 pMH1
897177 TM0266 DNA-binding protein, HU NP_228079 15643036 pMH1
897147 TM0245 Na-translocating NADH-quinone reductase, Nqr2 subunit NP_228059 15643017 pMH1
897054 TM0194 ABC transporter ATP-binding protein NP_228009 15642967 pMH1
897146 TM0244 electron transport complex protein NP_228058 15643016 pMH1
897090 TM0212 glycine cleavage system protein H NP_228027 15642985 pMH1
897052 TM0193 hypothetical protein NP_228008 15642966 pMH1
897260 TM0318 ubiquinone/menaquinone biosynthesis-related protein NP_228130 15643087 pMH1
897224 TM0299 LacI family transcription regulator NP_228111 15643068 pMH1
897172 TM0262 DNA polymerase III, beta subunit NP_228075 15643032 pMH1
897085 gcvT glycine cleavage system aminomethyltransferase T NP_228026 15642984 pMH1
897257 TM0316 hypothetical protein NP_228128<

There are no products listed under this category.

Subscribe to our newsletter

Terms & Conditions

Shipping Policy

Refunds & Returns

Privacy Policy

© TOPSAN | The Open Protein Structure Annotation Network.