null

SIRT7 Stable Knockdown H1299 Cell Line | T6165

(No reviews yet) Write a Review
SKU:
T6165
Availability:
5 to 7 Days Shipment
€4,173.00
Frequently bought together:

Description

abm | SIRT7 Stable Knockdown H1299 Cell Line | T6165

The sirtuin family of proteins have a diverse range of biological functions, accomplished by the deacetylation of their targets. Derived from H1299 cells, this Sirt7 knockdown cell line was displays lentiviral-driven stable expression shRNA scramble sequences and a Sirt7 specific shRNA. These cells would be suitable for use in the study of the functions of Sirt7 and the sirtuin family of proteins

Biosafety:

II

Organism:

Human (H. sapiens)

Source Organ:

Lung

Growth Properties:

Adherent

Morphology:

epithelial-like

Clones:

N/A

Passage Number:

N/A

Population Doner:

43 - 53 hours

Seeding Density:

10,000 - 20,000 cells/cm2

Markers:

Puromycin resistance at the concentration of 5 µg/mL. The cells stably express the short hairpin RNA (shRNA) scramble sequence: 5′-CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTT AGG-3′ and the Sirt7 specific shRNA 5′- CCGGGTCCAGCCTGAAGGTTCTAAACTCGAGTTTAGAACCTTCAGGCTGGACTTTTTG-3′.

Applications:

For Research Use Only

Doner Gender:

Male

Donor Ethnicity:

N/A

Knockdown Method:

N/A

Induction:

N/A

Overexpression:

N/A

Freeze Thaw:

N/A

Propagation:

The base medium for this cell line is Prigrow III medium available at abm

Preservation:

1. Freeze Medium: 90% FBS and 10% DMSO.
2. Storage Temperature: Liquid nitrogen vapour phase.

Quality Control:

1) Immunofluorescence; 2) DNA analysis and qPCR; 3) AgNOR staining

Tumorgenicn:

N/A

Shipping Conditions:

Dry Ice

Storage Contidions:

-180°C

View AllClose

Additional Information

Size:
10⁶ cells/1.0 ml
View AllClose